Craig Venter’s bugs might save the world
May 31, 2012 | Source: New York Times
Craig Venter (credit: Wikimedia
Inside the laboratories of biotechnology, a literal possibility of artificial life is taking hold: What if machines really were alive?
The possibility of designing a new organism, entirely from synthetic DNA, to produce whatever compounds we want, would mark a radical leap forward in biotechnology and a paradigm shift in manufacturing.
The appeal of biological machinery is manifold:
- Because organisms reproduce, they can generate not only their target product but also more factories to do the same.
- A custom organism could produce the same plastic or metal as an industrial plant while feeding on the compounds in pollution or the energy of the sun.
- As the world population continues to soar, adding nearly a billion people over the past decade, major aquifers are giving out, and agriculture may not be able to keep pace with the world’s needs. If a strain of algae could secrete high yields of protein, using less land and water than traditional crops, it may represent the best hope to feed a booming planet.
- The rise of biomachinery could usher in an era of “distributed manufacturing” by microbes. For example, customers could simply synthesize the bugs at home and grow them on their skin: “Living perfume”
In 2003, Venter’s lab used a new method to piece together a strip of DNA that was identical to a natural virus, then watched it spring to action and attack a cell. In 2008, they built a longer genome, replicating the DNA of a whole bacterium, and in 2010 they announced that they brought a bacterium with synthetic DNA to life.
In theory, this leaves just one step between Venter and a custom species. If he can change its genetic function in some deliberate way, he will have crossed the threshold to designer life.
If the promise of synthetic biology is expansive, the potential for catastrophe is plain. The greater the reach of biomachinery, the more urgent the need to understand its risks. Looking to the dawn of a biomachine age, many environmental groups worry that synthetic bugs could become the ultimate invasive species.
The reassurance offered by Venter and other proponents may not be convincing to everyone. A synthetic bug, they say, has little chance of surviving in the competitive natural ecosystem, and anyway, it could be designed to die without chemical support. In 2010, President Obama ordered his bioethics commission to examine the implications of Venter’s work, and the commission found “limited risks.”
“We’re doing a grand experiment. We’re trying to design the first cell from scratch.”
The synthetic biology that Venter proposes, using a minimal genome as a platform to make advances in food, fuel, medicine and environmental health, could backfire into a biological calamity, but it could also offer the most transformative approach to a medley of problems with no apparent solution.
Venter said he was just days away from trying the first synthesis of a minimal genome. “I call it the Hail Mary Genome.”
Comments (17)
by NakedApe
It’s the religious numbskulls who are against birthcontrol and women’s right to control their own bodies. So, it is they who are most to blame for our population explosion. Craig Venter is a genius and I applaud him for everything he is trying to do to benefit the human race. Evolution has created creatures with genuine intelligence, namely US, so let’s use it to solve our problems. The universe is HUGE, with effectively unlimited resources and we have trillions of years ahead of us, so let’s do all we can to over-ride this awful extinction that is programmed into our genes by evolution. I say, “Screw evolution! Let’s exceed its current limitations.” Evolution is an unconscious force and we are not morally obligated to owe it anything. “God” is a human construct that is used by an elite group of humans to confuse and control the rest of us while they burn our women at the stake and rape our children. Don’t let them! If we can conquer death, then let’s do it! It has been the dream of humankind ever since the rise of consciousness. The religious morons can just die, thinking that they will enter the Kingdom of Heaven. Good riddance to them! Let intelligence prevail on Earth and spread throughout this magnificent Universe, I say.
by karl
The greatest boon from the ability to create synthetic DNA, cells, life:
being able to re-create your own aging cells SYNTHETICALLY — voila you are now young again
by Jochen
Why is everyone so scared of dying? You anticipate it your entire life! It’s as natural as birth. If you grow old enough, you will be fine with it. Growing old enough though is the trick
by Peter Simmons
Hear hear! Some sense at last among the dreamers. Yes, I think all this belief in life extending, singularity et al is nothing more than death fear, which also drives all religions. So is this also a religion? Just a ‘hi-tech’ one? Then again, if this guy has his way, he might well ‘create’ the perfect unstoppable plague. A runaway relicator!
by Happy
You don’t mind those who you love die too? Disappear and never ever can talk to them anymore. You not scare of that? Well, if the technology really can help us become Immortal, young and health, you can choose not to use it but I am going to use it and live happily with my family. I love them very much.
But of course, they must do it properly and carefully. I hope in future, nobody will sick, old and sad. Everyone live happily. : )
by Allanx
Synthetic biology gives me the creeps, and with good reason. Inorganic machines are predictable and trustworthy. When released into the environment, they are practically inert, and only become more inert as time goes on and their components continue to decay. With artificial life forms, there always exists the possibility that you’ll create something which goes completely out of control and mutates in unexpected ways.
Even if an artificial virus or bacterium remains harmless on its own over several thousand generations, what if it undergoes lateral gene transfer with an existing disease-causing natural strain in the environment, possibly endowing it with drug resistance or other characteristics that enhance its lethality?
The way I see it, the likelihood of engineered life forms coming to represent an existential threat to mankind is far greater than the possibility of a machine – be it a sentient AI or Von Neumann machine – doing the same. We’re going to need some very powerful supercomputers to model all the possible interactions that these synthetic life forms could have with existing, natural organisms; the kind of computing power that we won’t have until at least eighteen years from now. We shouldn’t get ahead of ourselves.
by James Suter
Fully agree with you. In all likelihood, this may be one of these disasters that require us to expedite the creation of the AI Singularity in order to clean up such a monumental debacle of epic proportions. At least then it would be initially justified, but afterwards…
by Spikosauropod
I don’t dispute that.
My point is not that “synthetic life” is incompatible with belief in God. I just doubt it can be reconciled with the orthodox Abrahamic religions. I just don’t think “and then man created life” is going to fly with the big churches.
That said, December 21 is starting to seem pretty ominous.
It would be interesting to hear from a real theologian.
by James Suter
All of this sounds really good on the surface, but I sincerely hope all of you reading this share the same skepticism that I have about this proposition. I think we are a long way away from being able to understand the secondary, tertiary, and subsequent effects of creating artificial life that can reproduce, likely leak into the ecosystem, and, most significantly, mutate. In fact, I’ll flat out say it, doing so is completely foolish and reckless unless we fully and holistically understand the implications.
The “reassurance” offered does not reassure me at all, although I do need to do some further digging into this on my own. It’s also unwise to put faith in a government commission’s findings; I think we need more independent experts in this so that we can provide healthy counter-point. We simply do not know everything there is to know about DNA and how it interacts with and changes in response to environmental stimuli. It’s all fine and good that “fail safes” are put in place, but it could only take one or a series of critical mutations in one organism to create a plague. Who knows what those pieces of DNA at the end of the synthetic genome could do (e.g. lead to a certain mutation). You know, the those pieces that look like this:
CRAIGVENTER coded as: TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
VENTERINSTITVTE coded as: TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG TTAACTAGCTAA
HAMSMITH coded as: TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
CINDIANDCLYDE coded as: TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTA GCTAATGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGT CGCCCTAAAACAAAGTTAAACATCATG
GLASSANDCLYDE coded as: TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA
Maybe we should start by not encoding our names, hidden Easter eggs, or superfluous text into genomes. Just doesn’t seem like a good idea to me, and this does not help to strengthen the case for demonstrated “reassurance” mentioned in the article.
First, I propose we first develop a system that fully simulates our environment to a fine granular level so that we can test our “creations” in order to at least get a clue as to what could happen once we bring them into reality. What if a synthetic bacteria (that does a really great job at consuming crude oil) mutates into something that does a really great job at consuming other forms of oils or lipids…including cell membranes? It’s worth mentioning that the ecosystem itself will adapt at some point, but at what cost? Would it result in a cascading ecosystem failure? What would be the remedy? Would the remedy cause even more problems? I’d like to know if these questions are being thoroughly discussed and solved (and preferably not by committee or by people with excessive ego). Even then, I would argue, that the ability to fully understand these problems is way out of the league of human-level intelligence.
The BEST thing we can do is develop this aforementioned simulation so that we can test everything out before “going real-time”. At least it could show us the creations that would be of higher risk to the system than others. And even if we don’t have the real processing power for this now, we should at least be in the process of planning and designing such a system for whenever we do have the right hardware. We can’t afford an environmental catastrophe caused by synthetic life. Synthetic life can be a valuable strategy for us, but only if and when we really and truly know what we’re doing.
It is my greatest concern that we may one day encounter a major problem that requires us to develop a remedy expeditiously and that we may hastily resort to creating artificial life to “solve” the problem, because up front, it “works”. We, as a species, are great at solving the immediate problem at hand, but we are horrendous at understanding, mitigating, or preventing our solutions’ after effects, which can range from chronic annoyances to existential devastation.
Lastly, ultimately and overall, maybe we should simply just get a grip on ourselves and try not to “save the world”. Maybe our goal should be to seek more wisdom first and foremost. We are not living in a heroic novel or game, and there are major implications to all of our decisions that we make. It only takes one critical gaffe when it comes to this, and we do not have the option to “close the book” or “load from a saved game.” This is ground-breaking work, and I DO support it, but I think we need some more scaffolding in place before we move forward.
by Spikosauropod
It’s kind of a good litmus test for Abrahamic beliefs.
There is zero possibility that “synthetic life” is compatible with Judeo-Christian doctrine or Islam. Believing Jews Christians and Muslims must assume that God will be around any minute now to close up shop.
by Giulio Prisco
What are we but synthetic life? We are molecules put together by a molecular manipulation program designed by Mr. Darwin. Or, in other words, Mr. God. All good teachers want their student to become as good as them, or better.
by Peter Simmons
I can’t figure out from that whether you are being sardonic or are on your knees praying!
by Bri
I didn’t know that god left. Not for nothing , in an instant our world will be gone. Edgar Cayce said it would all change around the turn of the century. Ray refers it as a singularity. Impossible to see beyond. So unless I’m reading this wrong, the party is over. Soon your cell phone will be so Mitch smarter than all of us combined. Like Ray says , I’d rather have a carbon fibre skeleton,see bionically, smell with greater sensitivity than a dog, etc. We will merge with technology, and become something other tha human. It’s not a question of if. Craig is doing a fine job. We already have great biotech labs making pathogens. Look at swine flu, or drug resistant bacteria. No GM crop has mutated into a monster. DNA code is so complex it’s akin to a monkey randomly writing the constution, it just doesn’t work the way you think it does. I applaud Mr Ventors work. It is very safe. I wish our hospital were as prudent as he is. There are perils and promise to everything , from fire to nuclear. We have far more virulent things to worry about, like Putin or congress. People need to look and learn. To see and by this bring in the light of knowledge, and by this illuminate our world, not cower in cave of darkness. Truy examine this work for your selves, not pass uninformed judgements that can incite fear.
by Peter Simmons
‘No GM crop has mutated into a monster’ – yet. It’s an ongoing experiment. Spores from GM ‘field trails’ are already in the ionospherein large quantities, and what makes you think there’s been enough time for mutations to happen? You suggest others ‘examine this work for your selves, not pass uninformed judgements’ yet you pass a plethora of uninformed judgements such as ‘Mr Ventors work. It is very safe. ‘ and ‘Soon your cell phone will be so Mitch [sic] smarter than all of us combined.’ Pretty sweeping claims based on nothing.
by GatorALLin
As the world population continues to soar, adding nearly a billion people over the past decade, major aquifers are giving out, and agriculture may not be able to keep pace with the world’s needs. If a strain of algae could secrete high yields of protein, using less land and water than traditional crops, it may represent the best hope to feed a booming planet.
…so they have figured out that the world population will actually max out at 10 billion… see this ted video for cool stats. http://www.ted.com/talks/lang/en/hans_rosling_on_global_population_growth.html
by Peter Simmons
Not a ‘booming planet’ a suffering planet. The only thing booming is human numbers. Heard about all the extinctions we’ve called with our brainless breeding?
by GatorALLin
paging skynet….